Databases
StackOverflow2013
Postsdbo
PO
 

Note that there are some explanatory texts on larger screens.

plurals
  1. PO
    primarykey
    data
    text
    <p>The following script will return a count of sequences. It returns a dictionary with the individual, distinct sequences as keys and the numbers (the first part of each line) where these sequences occur. </p> <pre><code>#!/usr/bin/python import sys from collections import defaultdict def count_sequences(filename): result = defaultdict(list) with open(filename) as f: for index, line in enumerate(f): sequence = line.replace('\n', '') line_number = index + 1 result[sequence].append(line_number) return result if __name__ == '__main__': filename = sys.argv[1] for sequence, occurrences in count_sequences(filename).iteritems(): print "%s: %s, found in %s" % (sequence, len(occurrences), occurrences) </code></pre> <p>Sample output:</p> <pre><code>etc@etc:~$ python ./fasta.py /path/to/my/file GTCGTCGAAAGAGGCTT-GCCCGCTACGCGCCCCCTGATA: 1, found in ['4'] GTCGTCGAAAGAGGCTT-GCCCGCCACGCGCCCGCTGATA: 1, found in ['3'] GTCGTCGAAAGAGGTCT-GACCGCTTCGCGCCCGCTGGTA: 2, found in ['2', '5'] GTCGTCGAAAGAGGTCT-GACCGCTTCTCGCCCGCTGATA: 1, found in ['7'] GTCGTCGAAGCATGCCGGGCCCGCTTCGTGTTCGCTGATA: 1, found in ['1'] GTCGTCGAAAGAGTCTGACCGCTTCTCGCCCGCTGATACG: 1, found in ['6'] </code></pre> <p><strong>Update</strong></p> <p>Changed code to use <code>dafaultdict</code> and <code>for</code> loop. Thanks <a href="https://stackoverflow.com/users/224671/kennytm">@KennyTM</a>.</p> <p><strong>Update 2</strong></p> <p>Changed code to use <code>append</code> rather than <code>+</code>. Thanks <a href="https://stackoverflow.com/users/3171/dave-webb">@Dave Webb</a>.</p>
    singulars
    1. This table or related slice is empty.
    1. PObest way to compare sequence of letters inside file?
      singulars
      1. PTQuestion
    1. PTAnswer
    1. USCommunity
    1. USManoj Govindan
    plurals
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. VO
      singulars
      1. PO
      1. This table or related slice is empty.
      1. VTUpMod
    2. VO
      singulars
      1. PO
      1. This table or related slice is empty.
      1. VTUpMod
    1. COdefaultdict, for loop...
      singulars
      1. PO
      1. USkennytm
    2. CO@KenntyTM: +1. Done. Thanks.
      singulars
      1. PO
      1. USManoj Govindan
    3. COthanks a lot!A great help
      singulars
      1. PO
      1. USpsoares
 

Querying!

 
Guidance
A row detail

Detail views are divided into sections. All the information in the data section comes from columns in the selected row. The other sections display data from other, related rows.

Related data can be related in a to-one or a to-many fashion. Captions of data related in a to-many fashion link to a list view showing a filtered view of the table.

Try moving around until you find a non-empty to-many entry and click on the label to get to one. You can move back to the root by clicking on the database name in the header.

SQuiL has stopped working due to an internal error.

If you are curious you may find further information in the browser console, which is accessible through the devtools (F12).

Reload