Databases
StackOverflow2013
Postsdbo
POExtracting nucleotide sequence from a non-standardly formatted text file
 

Note that there are some explanatory texts on larger screens.

plurals
  1. POExtracting nucleotide sequence from a non-standardly formatted text file
    primarykey
    data
    text
    <p>I have been given some DNA sequences by collaborators in a word document that I'd like to convert into a series of fasta sequences in one file.</p> <p>I've made it into a text file and I figured that using regular expressions to extract the gene name and the sequence:</p> <pre><code>use warnings; use strict; die "usage: make_fasta.pl &lt;sequence file&gt;" unless (@ARGV == 1); my $seq_filename = shift; my $fasta_db_name = $seq_filename . "_db.fa"; open(my $seq_file, '&lt;', $seq_filename) or die "can't open file $seq_filename, $!"; open(my $fasta_file, '&gt;', $fasta_db_name) or die "can't open file $fasta_db_name, $!"; while (my $line = &lt;$seq_file&gt;) { chomp $line; if ($line =~ /^[ATCG]+$/) { # if the line is entirely DNA seqence print $fasta_file "$line\n"; } elsif ($line =~ /Full-length (\w+) cDNA/) { # if the line has gene info print $fasta_file "&gt;$1\n"; } else { next; } } </code></pre> <p>But that just gave me the name of the first gene. Clearly I've done something wrong with the DNA regular expression but I can't for the life of me work it out. To my eyes it's exactly the same as other suggested DNA tests I've found on this site and others.</p> <p>The file I'm trying to parse is configured like so:</p> <pre><code>Collaborators name title of gene set Full-length clock cDNA coding sequence ATGGTAGGATGTGTAATGCGTACGTGATCGT Full-length per cDNA coding sequence ATGCTAGCTACGTACGTAGCTACGTAGTACG </code></pre> <p>I want the output to be a fasta file so:</p> <pre><code>&gt;clock ATGGTAGGATGTGTAATGCGTACGTGATCGT &gt;per ATGCTAGCTACGTACGTAGCTACGTAGTACG </code></pre> <p>The first few lines of the actual input file are:</p> <pre><code>Dr Lin Zhang (Leicester University 10/2012) Canonical clock genes Full-length per cDNA coding seq (3693bp) ATGGACACAGGAACACCCCATGAAGATGTGCCCTCAGAGGACCACACCTTGGAAGAAGGGGACAGCAAGAACCCCTCGTGCCAGCAAGAGTCAGCCTACGGCTCCCTCGAGTCATCCTCCAATGGACAGTCTCAGAAAAGTTTCGGAGGAAGTGGAAGCAAAAGCTTAAATAGTGGTTCGAGTCACAGCAGCGGCTTTGGGGACCAAAATGATTTCAAGGGTATCCATCTTCACGAAGCGAAACACATAGCGTTGAAGAAGAAGAAAACTGGGAAAGGAGGTGAAAAGGTAGCAGAAATCCCCTTTCAAACTGCCTCTGAGGCAGAACTGTCCTCCAAAGGAAACGAAACAGAAAAGGAGAAAGAAACAAGCCTCGAGGAGTCTCCTGCTGCAAAAGAGGAAGCAATTATCGAAAAGGAGTCTCGTTACATCCACCCGAGGAACT </code></pre>
    singulars
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. PTQuestion
    1. USuser2427650
    1. USuser2427650
    plurals
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. PO
      singulars
      1. PTAnswer
    2. PO
      singulars
      1. PTAnswer
    1. This table or related slice is empty.
    1. COHow should look data structure of parsed input file?
      singulars
      1. POExtracting nucleotide sequence from a non-standardly formatted text file
      1. USСухой27
    2. COCould it be that there is whitespace at the end of the line?
      singulars
      1. POExtracting nucleotide sequence from a non-standardly formatted text file
      1. USTim Pietzcker
    3. COIf I were to run the code you posted and give it an input file containing the example data you provided, what should the output be? (Assuming I first added "cDNA" to the end of the "Full length..." lines, of course.)
      singulars
      1. POExtracting nucleotide sequence from a non-standardly formatted text file
      1. USDave Sherohman
 

Querying!

 
Guidance
A row detail

Detail views are divided into sections. All the information in the data section comes from columns in the selected row. The other sections display data from other, related rows.

Related data can be related in a to-one or a to-many fashion. Captions of data related in a to-many fashion link to a list view showing a filtered view of the table.

Try moving around until you find a non-empty to-many entry and click on the label to get to one. You can move back to the root by clicking on the database name in the header.

SQuiL has stopped working due to an internal error.

If you are curious you may find further information in the browser console, which is accessible through the devtools (F12).

Reload