Databases
StackOverflow2013
Postsdbo
POSplitting large txt file into small ones based on specific content
 

Note that there are some explanatory texts on larger screens.

plurals
  1. POSplitting large txt file into small ones based on specific content
    primarykey
    data
    text
    <p>I got a large sequence of genome and I need to split it into small .txt files.</p> <p>Sequence looks like this</p> <pre><code>&gt;supercont1.1 of Geomyces destructans 20631-21 AGATTTTCTTAATAACTTGTTCAATGTGTGTTCAAATGATATGCCGTGATGTATGTAGCA TAAACAGATGTAGTAGAAGAGTTTGCAGCAATCGTTGAGTAGTATTGCTTCTGTTGTTGG &gt;supercont1.2 of Geomyces destructans 20631-21 AGATTTTCTTAATAACTTGTTCAATGTGTGTTCAAATGATATGCCGTGATGTATGTAGCA TAAACAGATGTAGTAGAAGAGTTTGCAGCAATCGTTGAGTAGTATTGCTTCTGTTGTTGG TAAACAGATGTAGTAGAAGAGTTTGCAGCAATCGTTGAGTAGTATTGCTTCTGTTGTTGG &gt;supercont1.3 of Geomyces destructans 20631-21 AGATTTT (...) </code></pre> <p>And it should be splitted into small files with names: "1.1-Geomyces-destructans--20631-21", "1.2-Geomyces..." fulfilled with genome data.</p> <p>My code after @JimMischel help looks like: </p> <pre><code>using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; using System.IO; namespace genom1 { public partial class Form1 : Form { public Form1() { InitializeComponent(); } string filter = "Textové soubory|*.txt|Soubory FASTA|*.fasta|Všechny soubory|*.*"; private void doit_Click(object sender, EventArgs e) { bar.Value = 0; OpenFileDialog opf = new OpenFileDialog(); // filter for choosing file types opf.Filter = filter; string lineo = "error"; // test if (opf.ShowDialog() == DialogResult.OK) { var lineCount = 0; using (var reader = File.OpenText(opf.FileName)) { while (reader.ReadLine() != null) { lineCount++; } } bar.Maximum = lineCount; bar.Step = 1; FolderBrowserDialog fbd = new FolderBrowserDialog(); fbd.Description = "Vyber složku, do které chceš rozdělit načtený soubor: \n\n" + opf.FileName; // dialog desc if (fbd.ShowDialog() == DialogResult.OK) { List&lt;string&gt; lines = new List&lt;string&gt;(); foreach (var line in File.ReadLines(opf.FileName)) { bar.PerformStep(); if (line[0] == '&gt;') { if (lines.Count &gt;= 0) { // write contents of lines list to file //quicker replace for better file name StringBuilder prep = new StringBuilder(line); prep.Replace("&gt;supercont", ""); prep.Replace("of", ""); prep.Replace(" ", "-"); lineo = prep.ToString(); // append or writeall? how to writeall lines without append? //System.IO.File.WriteAllText(fbd.SelectedPath + "\\" + lineo + ".txt", lineo); StreamWriter SW; SW = File.AppendText(fbd.SelectedPath + "\\" + lineo + ".txt"); foreach (string s in lines) { SW.WriteLine(s); } SW.Close(); // and clear the list. lines.Clear(); } } lines.Add(line); } // here, do the last part if (lines.Count &gt;= 0) { // write contents of lines list to file. /* starts being little buggy here... StreamWriter SW; SW = File.AppendText(fbd.SelectedPath + "\\" + lineo + ".txt"); foreach (string s in lines) { SW.WriteLine(s); } SW.Close(); */ } } } } } } </code></pre>
    singulars
    1. PO
      singulars
      1. PTAnswer
    1. This table or related slice is empty.
    1. PTQuestion
    1. USuser1337432
    1. USuser1337432
    plurals
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. This table or related slice is empty.
    1. PO
      singulars
      1. PTAnswer
    2. PO
      singulars
      1. PTAnswer
    1. VO
      singulars
      1. POSplitting large txt file into small ones based on specific content
      1. This table or related slice is empty.
      1. VTUpMod
    1. This table or related slice is empty.
 

Querying!

 
Guidance
A row detail

Detail views are divided into sections. All the information in the data section comes from columns in the selected row. The other sections display data from other, related rows.

Related data can be related in a to-one or a to-many fashion. Captions of data related in a to-many fashion link to a list view showing a filtered view of the table.

Try moving around until you find a non-empty to-many entry and click on the label to get to one. You can move back to the root by clicking on the database name in the header.

SQuiL has stopped working due to an internal error.

If you are curious you may find further information in the browser console, which is accessible through the devtools (F12).

Reload